rnjB [2019-02-24 18:09:58]

RNase J2

Locus: BSU16780

Isoelectric point: 9.18

Molecular weight: 56.67 kDa

Protein length: 555 aa

Gene length: 1668 bp

Function: RNA processing and degradation

Product: RNase J2

Essential: no

Synonyms: ymfA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → RNA synthesis and degradation → RNases → Endoribonucleases

Gene

Coordinates: 1,749,418 → 1,751,085

Phenotypes of a mutant

• growth advantage at low pressure and at 27°C at normal pressure (has been selected at low pressure) PubMed

The protein

Catalyzed reaction/ biological activity

• endoribonuclease, involved in processing of thrS mRNA

Protein family

• metallo-beta-lactamase superfamily (according to UniProt)
• RNase J subfamily (according to Swiss-Prot)

Paralogous protein(s)

• RnjA

Structure

• 3ZQ4, RNase J1, 49% identity, 81% similarity PubMed

Localization

• cytoplasm, colocalizes with the ribosomes PubMed

Expression and Regulation

Operons

• Genes: rnjB
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulation

  • constitutive expression PubMed

Biological materials

Mutant

• MGNA-B114 (ymfA::erm), available at the NBRP B. subtilis, Japan
• GP1113 (rnjB::miniTn10 spc), available in Jörg Stülke's lab
• GP1291 (ΔrnjB::cat), available in Jörg Stülke's lab
• BKE16780 (ΔrnjB::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG
• BKK16780 (ΔrnjB::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAAATCTATATCCTCCTAG, downstream forward: _UP4_TAATGACTGACTAAAGACCG

Expression vectors

• GP1687, chromosomal expression of rnjB-Strep::kan in B. subtilis, available in Jörg Stülke's lab
• GP1724, chromosomal expression of rnjB-Strep::spc in B. subtilis, based on pGP1389, available in Jörg Stülke's lab
• pGP1438: IPTG inducible expression, purification in E. coli with N-terminal His-tag, in pWH844, available in Jörg Stülke's lab
• pGP1440: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

LacZ fusion

• pGP419 (in pAC7), available in Jörg Stülke's lab

GFP fusion

• GP1695 (in pHJS-105 PubMed), expression of rnjB-sfGFP::spc under a xylose-inducible promoter in B. subtilis, available in Jörg Stülke's lab PubMed
• GP1699 (in pBP43), expression of rnjB-GFP::spc under the native promoter, available in Jörg Stülke's lab PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab, PubMed

FLAG-tag construct

• GP1001 (spc, based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Harald Putzer, IBPC Paris, France Homepage

References

Reviews

Loading

Original publications

Loading